IKB beta (NFKBIB) (NM_002503) Human 3' UTR Clone

CAT#: SC200212

3`UTR clone of nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor beta (NFKBIB) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: NFKBIB
• Synonyms: IKBB; TRIP9
• ACCN: NM_002503
• Insert Size: 102 bp
• Sequence Data:
  Insert Sequence

  >SC200212 3'UTR clone of NM_002503
  The sequence shown below is from the reference sequence of NM_002503. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAGCCTCAAAACCTCTTCCTGACGACCCCCGCCCCGTGTGATTTGTTTCATTGTTAATATAATTTCCAGT
  TTAATAAACAAAACCCTAGTTCTGACAACCAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002503.3
• Summary: 'The protein encoded by this gene belongs to the NF-kappa-B inhibitor family, which inhibit NF-kappa-B by complexing with, and trapping it in the cytoplasm. Phosphorylation of serine residues on these proteins by kinases marks them for destruction via the ubiquitination pathway, thereby allowing activation of the NF-kappa-B, which translocates to the nucleus to function as a transcription factor. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Jul 2011]'
• Locus ID: 4793