ATP5PD (NM_001003785) Human 3' UTR Clone
CAT#: SC200327
3`UTR clone of ATP synthase H+ transporting mitochondrial F0 complex subunit d (ATP5H) nuclear gene encoding mitochondrial protein transcript variant 2
Product Images
Other products for "ATP5PD"
Specifications
Product Data | |
Vector | pMirTarget |
Species | Human |
Transfection Reporter | RFP |
Assay Reporter | Luciferase |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Symbol | ATP5PD |
Synonyms | APT5H; ATP5H; ATPQ |
ACCN | NM_001003785 |
Insert Size | 87 bp |
Sequence Data |
>SC200327 3'UTR clone of NM_001003785
The sequence shown below is from the reference sequence of NM_001003785. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon CAATTGGCAGAGCTCAGAATTCAAGCGATCGC GTATCCCTATTGGCCTCACCAACCAATTGAGAATTTATAAAATTGAGTCCAGGAGGAAGCTCTGGCCCTT GTATTACACATTCTGGA ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG |
Restriction Sites | SgfI-MluI |
OTI Disclaimer | Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. |
Reference Data | |
RefSeq | NM_001003785.1 |
Summary | Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. It is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, which comprises the proton channel. The F1 complex consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled in a ratio of 3 alpha, 3 beta, and a single representative of the other 3. The Fo seems to have nine subunits (a, b, c, d, e, f, g, F6 and 8). This gene encodes the d subunit of the Fo complex. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. In addition, three pseudogenes are located on chromosomes 9, 12 and 15. [provided by RefSeq, Jun 2010] |
Locus ID | 10476 |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.