GABRQ (NM_018558) Human 3' UTR Clone

CAT#: SC200363

3`UTR clone of gamma-aminobutyric acid (GABA) receptor theta (GABRQ) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GABRQ
• Synonyms: THETA
• ACCN: NM_018558
• Insert Size: 98
• Sequence Data:
  Insert Sequence

  >SC200363 3'UTR clone of NM_018558
  The sequence shown below is from the reference sequence of NM_018558. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCTTTGGGTTGTTCAACATTGTTTACTGGGTATACCATATGTATTAGTCCCCCAGTGCTCCAGAACAGCG
  GGAGCACTGTGCTGTGCTCCTTTCAGTT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_018558.2
• Summary: The gamma-aminobutyric acid (GABA) A receptor is a multisubunit chloride channel that mediates the fastest inhibitory synaptic transmission in the central nervous system. This gene encodes the theta subunit of the GABA A receptor. The gene is mapped to chromosome Xq28 in a cluster of genes including those that encode the alpha 3 and epsilon subunits of the GABA A receptor. [provided by RefSeq, Jul 2017]
• Locus ID: 55879