ACP6 (NM_016361) Human 3' UTR Clone

CAT#: SC200368

3`UTR clone of acid phosphatase 6 lysophosphatidic (ACP6) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ACP6
• Synonyms: ACPL1; LPAP; PACPL1
• ACCN: NM_016361
• Insert Size: 89
• Sequence Data:
  Insert Sequence

  >SC200368 3'UTR clone of NM_016361
  The sequence shown below is from the reference sequence of NM_016361. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTCAGGTGATGGAAGTTGGAAATGAAGAGTAACTGATTTATAAAAGCAGGATGTGTTGATTTTAAAATAA
  AGTGCCTTTATACAATGCC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_016361.3
• Summary: This gene encodes a member of the histidine acid phosphatase protein family. The encoded protein hydrolyzes lysophosphatidic acid, which is involved in G protein-coupled receptor signaling, lipid raft modulation, and in balancing lipid composition within the cell. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2016]
• Locus ID: 51205