ACP6 (NM_016361) Human 3' UTR Clone
CAT#: SC200368
3`UTR clone of acid phosphatase 6 lysophosphatidic (ACP6) for miRNA target validation
Product Images
Other products for "ACP6"
Specifications
Product Data | |
Vector | pMirTarget |
Species | Human |
Transfection Reporter | RFP |
Assay Reporter | Luciferase |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Symbol | ACP6 |
Synonyms | ACPL1; LPAP; PACPL1 |
ACCN | NM_016361 |
Insert Size | 89 |
Sequence Data |
>SC200368 3'UTR clone of NM_016361
The sequence shown below is from the reference sequence of NM_016361. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon CAATTGGCAGAGCTCAGAATTCAAGCGATCGC CTCAGGTGATGGAAGTTGGAAATGAAGAGTAACTGATTTATAAAAGCAGGATGTGTTGATTTTAAAATAA AGTGCCTTTATACAATGCC ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG |
Restriction Sites | SgfI-MluI |
OTI Disclaimer | Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs). |
Reference Data | |
RefSeq | NM_016361.3 |
Summary | This gene encodes a member of the histidine acid phosphatase protein family. The encoded protein hydrolyzes lysophosphatidic acid, which is involved in G protein-coupled receptor signaling, lipid raft modulation, and in balancing lipid composition within the cell. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2016] |
Locus ID | 51205 |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.