SH2B2 (NM_020979) Human 3' UTR Clone

CAT#: SC200402

3`UTR clone of SH2B adaptor protein 2 (SH2B2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SH2B2
• Synonyms: APS
• ACCN: NM_020979
• Insert Size: 109
• Sequence Data:
  Insert Sequence

  >SC200402 3'UTR clone of NM_020979
  The sequence shown below is from the reference sequence of NM_020979. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCGTGGAGAACCAGTACTCCTTCTACTAGCCCGCGGCGCCGCCCGGGTGGGACACGCCAAGCTCTTCAGT
  GAAGACACGATGTTATTAAAAGCCTGTTTTAGGGACTGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_020979.3
• Summary: The protein encoded by this gene is expressed in B lymphocytes and contains pleckstrin homology and src homology 2 (SH2) domains. In Burkitt's lymphoma cell lines, it is tyrosine-phosphorylated in response to B cell receptor stimulation. Because it binds Shc independent of stimulation and Grb2 after stimulation, it appears to play a role in signal transduction from the receptor to the Shc/Grb2 pathway. [provided by RefSeq, Jun 2009]
• Locus ID: 10603