Antithrombin III (SERPINC1) (NM_000488) Human 3' UTR Clone

CAT#: SC200416

3`UTR clone of serpin peptidase inhibitor clade C (antithrombin) member 1 (SERPINC1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SERPINC1
• Synonyms: AT3; AT3D; ATIII; ATIII-R2; ATIII-T1; ATIII-T2; THPH7
• ACCN: NM_000488
• Insert Size: 110 bp
• Sequence Data:
  Insert Sequence

  >SC200416 3'UTR clone of NM_000488
  The sequence shown below is from the reference sequence of NM_000488. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGAGTAGCCAACCCTTGTGTTAAGTAAAATGTTCTTATTCTTTGCACCTCTTCCTATTTTTGGTTTGTGA
  ACAGAAGTAAAAATAAATACAAACTACTTCCATCTCACAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000488.3
• Summary: 'The protein encoded by this gene, antithrombin III, is a plasma protease inhibitor and a member of the serpin superfamily. This protein inhibits thrombin as well as other activated serine proteases of the coagulation system, and it regulates the blood coagulation cascade. The protein includes two functional domains: the heparin binding-domain at the N-terminus of the mature protein, and the reactive site domain at the C-terminus. The inhibitory activity is enhanced by the presence of heparin. Numerous mutations have been identified for this gene, many of which are known to cause antithrombin-III deficiency which constitutes a strong risk factor for thrombosis. A reduction in the serum level of this protein is associated with severe cases of Coronavirus Disease 19 (COVID-19). [provided by RefSeq, Sep 2020]'
• Locus ID: 462