PPP1R14A (NM_033256) Human 3' UTR Clone

CAT#: SC200419

3`UTR clone of protein phosphatase 1 regulatory (inhibitor) subunit 14A (PPP1R14A) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PPP1R14A
• Synonyms: CPI-17; CPI17; PPP1INL
• ACCN: NM_033256
• Insert Size: 68
• Sequence Data:
  Insert Sequence

  >SC200419 3'UTR clone of NM_033256
  The sequence shown below is from the reference sequence of NM_033256. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGACTGCTCACCCCTGACCCTCTTGCACTCTCCCTGCCCCCCGGACGCCGCCCAGCTTGCTTGTGTAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_033256.1
• Summary: The protein encoded by this gene belongs to the protein phosphatase 1 (PP1) inhibitor family. This protein is an inhibitor of smooth muscle myosin phosphatase, and has higher inhibitory activity when phosphorylated. Inhibition of myosin phosphatase leads to increased myosin phosphorylation and enhanced smooth muscle contraction. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Sep 2011]
• Locus ID: 94274