valyl tRNA synthetase (VARS) (NM_006295) Human 3' UTR Clone

CAT#: SC200487

3`UTR clone of valyl-tRNA synthetase (VARS) nuclear gene encoding mitochondrial protein for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: VARS
• Synonyms: G7A; NDMSCA; VARS1; VARS2
• ACCN: NM_006295
• Insert Size: 105 bp
• Sequence Data:
  Insert Sequence

  >SC200487 3'UTR clone of NM_006295
  The sequence shown below is from the reference sequence of NM_006295. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TCAGGAAGGTGGATGAGGCCATCGCCCTATTCCAGAAGATGCTGTGATCCACCACCCAGCTTCACCCCTC
  ACCCCCAGCGGCTCACCATGGGGATGGCAGCAATA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_006295.2
• Summary: 'Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. The protein encoded by this gene belongs to class-I aminoacyl-tRNA synthetase family and is located in the class III region of the major histocompatibility complex. [provided by RefSeq, Jul 2008]'
• Locus ID: 7407