Vitronectin (VTN) (NM_000638) Human 3' UTR Clone

CAT#: SC200508

3`UTR clone of vitronectin (VTN) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: VTN
• Synonyms: V75; VN; VNT
• ACCN: NM_000638
• Insert Size: 122 bp
• Sequence Data:
  Insert Sequence

  >SC200508 3'UTR clone of NM_000638
  The sequence shown below is from the reference sequence of NM_000638. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CATCGCTCAGTACTGGCTGGGCTGCCCAGCTCCTGGCCATCTGTAGGAGTCAGAGCCCACATGGCCGGGC
  CCTCTGTAGCTCCCTCCTCCCATCTCCTTCCCCCAGCCCAATAAAGGTCCCT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000638.3
• Summary: 'The protein encoded by this gene functions in part as an adhesive glycoprotein. Differential expression of this protein can promote either cell adhesion or migration as it links cells to the extracellular matrix through a variety of ligands. These ligands include integrins, plasminogen activator inhibitor-1, and urokinase plasminogen activator receptor. This secreted protein can be present in the plasma as a monomer or dimer and forms a multimer in the extracellular matrix of several tissues. This protein also inhibits the membrane-damaging effect of the terminal cytolytic complement pathway and binds to several serpin serine protease inhibitors. This protein can also promote extracellular matrix degradation and thus plays a role in tumorigenesis. It is involved in a variety of other biological processes such as the regulation of the coagulation pathway, wound healing, and tissue remodeling. The heparin-binding domain of this protein give it anti-microbial properties. It is also a lipid binding protein that forms a principal component of high density lipoprotein. [provided by RefSeq, Aug 2020]'
• Locus ID: 7448