HIST1H2BD (NM_021063) Human 3' UTR Clone
CAT#: SC200516
3`UTR clone of histone cluster 1 H2bd (HIST1H2BD) transcript variant 1 for miRNA target validation
Product Images
Other products for "HIST1H2BD"
Specifications
Product Data | |
Vector | pMirTarget |
Species | Human |
Transfection Reporter | RFP |
Assay Reporter | Luciferase |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Symbol | HIST1H2BD |
Synonyms | dJ221C16.6; H2B.1B; H2B/a; H2B/b; H2B/g; H2B/h; H2B/k; H2B/l; H2BFA; H2BFB; H2BFG; H2BFH; H2BFK; H2BFL; HIRIP2; HIST1H2BC; HIST1H2BE; HIST1H2BF; HIST1H2BG; HIST1H2BI |
ACCN | NM_021063 |
Insert Size | 89 bp |
Sequence Data |
>SC200516 3'UTR clone of NM_021063
The sequence shown below is from the reference sequence of NM_021063. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon CAATTGGCAGAGCTCAGAATTCAAGCGATCGC CACCAAGTACACCAGTTCCAAGTAACTTTGCCAAGTAAGCATCTTTACACCTAATCCCAAAGGCTCTTTT AAGAGCCACGCATGTTTTC ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG |
Restriction Sites | SgfI-MluI |
OTI Disclaimer | Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. |
Reference Data | |
RefSeq | NM_021063.2 |
Summary | 'Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2B family. Two transcripts that encode the same protein have been identified for this gene, which is found in the large histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq, Aug 2015]' |
Locus ID | 3017 |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.