PQBP1 (NM_005710) Human 3' UTR Clone
CAT#: SC200539
3`UTR clone of polyglutamine binding protein 1 (PQBP1) transcript variant 1 for miRNA target validation
Product Images
Other products for "PQBP1"
Specifications
Product Data | |
Vector | pMirTarget |
Species | Human |
Transfection Reporter | RFP |
Assay Reporter | Luciferase |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Symbol | PQBP1 |
Synonyms | MRX2; MRX55; MRXS3; MRXS8; NPW38; RENS1; SHS |
ACCN | NM_005710 |
Insert Size | 74 |
Sequence Data |
>SC200539 3'UTR clone of NM_005710
The sequence shown below is from the reference sequence of NM_005710. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon CAATTGGCAGAGCTCAGAATTCAAGCGATCGC GAACCAAGCAGCAGGATTGAAGCTTCGGCCTCCCTGGCCCTGGGTTAAAATAAAAGCTTTCTGGTGATCC TGCC ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG |
Restriction Sites | SgfI-MluI |
OTI Disclaimer | Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs). |
Reference Data | |
RefSeq | NM_005710.2 |
Summary | This gene encodes a nuclear polyglutamine-binding protein that is involved with transcription activation. The encoded protein contains a WW domain. Mutations in this gene have been found in patients with Renpenning syndrome 1 and other syndromes with X-linked cognitive disability. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Nov 2009] |
Locus ID | 10084 |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.