XPG (ERCC5) (NM_000123) Human 3' UTR Clone

CAT#: SC200561

3`UTR clone of excision repair cross-complementing rodent repair deficiency complementation group 5 (ERCC5) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ERCC5
• Synonyms: COFS3; ERCC5-201; ERCM2; UVDR; XPG; XPGC
• ACCN: NM_000123
• Insert Size: 133 bp
• Sequence Data:
  Insert Sequence

  >SC200561 3'UTR clone of NM_000123
  The sequence shown below is from the reference sequence of NM_000123. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGAAACTAAGACGTGCGAGGGGAAGAAAAAGGAAAACCTAATTAAAAAATATGTATCCTCTATAATTAGT
  TATGACAGCCATTTGTAATGAATTTGTCGCAAAGACGTAATAAAATTAACTGGTGGCACGGTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000123.2
• Summary: 'This gene encodes a single-strand specific DNA endonuclease that makes the 3' incision in DNA excision repair following UV-induced damage. The protein may also function in other cellular processes, including RNA polymerase II transcription, and transcription-coupled DNA repair. Mutations in this gene cause xeroderma pigmentosum complementation group G (XP-G), which is also referred to as xeroderma pigmentosum VII (XP7), a skin disorder characterized by hypersensitivity to UV light and increased susceptibility for skin cancer development following UV exposure. Some patients also develop Cockayne syndrome, which is characterized by severe growth defects, cognitive disability, and cachexia. Read-through transcription exists between this gene and the neighboring upstream BIVM (basic, immunoglobulin-like variable motif containing) gene. [provided by RefSeq, Feb 2011]'
• Locus ID: 2073