USP33 (NM_201626) Human 3' UTR Clone

CAT#: SC200596

3`UTR clone of ubiquitin specific peptidase 33 (USP33) transcript variant 3 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: USP33
• Synonyms: VDU1
• ACCN: NM_201626
• Insert Size: 103
• Sequence Data:
  Insert Sequence

  >SC200596 3'UTR clone of NM_201626
  The sequence shown below is from the reference sequence of NM_201626. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGAAGAAAAACTGAATTGGAAATTTTTATTCGGGTAAAAAAGTGATGCTTTTCAAATTGATCTAGGATAA
  AGATGAAGACCTGACAATTATCAGAGTTATATG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_201626.1
• Summary: This gene encodes a deubiquinating enzyme important in a variety of processes, including Slit-dependent cell migration and beta-2 adrenergic receptor signaling. The protein is negatively regulated through ubiquitination by von Hippel-Lindau tumor protein (VHL). Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jun 2012]
• Locus ID: 23032