TCIRG1 (NM_006053) Human 3' UTR Clone

CAT#: SC200604

3`UTR clone of T-cell immune regulator 1 ATPase H+ transporting lysosomal V0 subunit A3 (TCIRG1) transcript variant 2


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "TCIRG1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol TCIRG1
Synonyms a3; Atp6i; ATP6N1C; ATP6V0A3; OC-116kDa; OC116; OPTB1; Stv1; TIRC7; Vph1
ACCN NM_006053
Insert Size 93
Sequence Data
>SC200604 3'UTR clone of NM_006053
The sequence shown below is from the reference sequence of NM_006053. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TTCACCTTCGCTGCCACAGATGACTAGGGCCCACTGCAGGTCCTGCCAGACCTCCTTCCTGACCTCTGAG
GCAGGAGAGGAATAAAGACGGTC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006053.2
Summary This gene encodes a subunit of a large protein complex known as a vacuolar H+-ATPase (V-ATPase). The protein complex acts as a pump to move protons across the membrane. This movement of protons helps regulate the pH of cells and their surrounding environment. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, and receptor-mediated endocytosis. V-ATPase is comprised of a cytosolic V1 domain and a transmembrane V0 domain. Alternative splicing results in multiple transcript variants. Mutations in this gene are associated with infantile malignant osteopetrosis. [provided by RefSeq, May 2017]
Locus ID 10312

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.