EXOSC4 (NM_019037) Human 3' UTR Clone

CAT#: SC200611

3`UTR clone of exosome component 4 (EXOSC4) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: EXOSC4
• Synonyms: hRrp41p; p12A; RRP41; RRP41A; Rrp41p; SKI6; Ski6p
• ACCN: NM_019037
• Insert Size: 68
• Sequence Data:
  Insert Sequence

  >SC200611 3'UTR clone of NM_019037
  The sequence shown below is from the reference sequence of NM_019037. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CGGCAGCATGTGCGTGAGGCCTCTATCTTGCTGGGGGACTGACCACCCAGCCACCCATGTCCAGAATA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_019037.2
• Locus ID: 54512