FLAD1 (NM_025207) Human 3' UTR Clone

CAT#: SC200616

3`UTR clone of FAD1 flavin adenine dinucleotide synthetase homolog (S. cerevisiae) (FLAD1) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: FLAD1
• Synonyms: FAD1; FADS; LSMFLAD; PP591
• ACCN: NM_025207
• Insert Size: 103
• Sequence Data:
  Insert Sequence

  >SC200616 3'UTR clone of NM_025207
  The sequence shown below is from the reference sequence of NM_025207. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAAGAAGAGGAGCGGAACTCCCGCACATGACCTCCCACCCTAGGAGGGAGGGAAGGACACCGTCCTAGGG
  TATAACCTGGCAATAAACCGTGCCTCTCACTGT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_025207.3
• Summary: This gene encodes the enzyme that catalyzes adenylation of flavin mononucleotide (FMN) to form flavin adenine dinucleotide (FAD) coenzyme. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
• Locus ID: 80308