OPLAH (NM_017570) Human 3' UTR Clone

CAT#: SC200650

3`UTR clone of 5-oxoprolinase (ATP-hydrolysing) (OPLAH) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: OPLAH
• Synonyms: 5-Opase; OPLA; OPLAHD
• ACCN: NM_017570
• Insert Size: 73
• Sequence Data:
  Insert Sequence

  >SC200650 3'UTR clone of NM_017570
  The sequence shown below is from the reference sequence of NM_017570. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAGCGTCTATGAGTATCGCCGGGCCCAGGAGGCCGTGTGAGGATCCCGCAATAAAGATGCCTTAAGTCTC
  CCG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_017570.3
• Summary: The protein encoded by this gene acts as a homodimer, using ATP hydrolysis to catalyze the conversion of 5-oxo-L-proline to L-glutamate. Defects in this gene are a cause of 5-oxoprolinase deficiency (OPLAHD). [provided by RefSeq, Jun 2012]
• Locus ID: 26873