PNMT (NM_002686) Human 3' UTR Clone

CAT#: SC200698

3`UTR clone of phenylethanolamine N-methyltransferase (PNMT) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PNMT
• Synonyms: PENT; PNMTase
• ACCN: NM_002686
• Insert Size: 80 bp
• Sequence Data:
  Insert Sequence

  >SC200698 3'UTR clone of NM_002686
  The sequence shown below is from the reference sequence of NM_002686. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTCAGAAGGTTGGGCTGTGAGGGCTGTACCTGGTGCCCTGTGGCCCCCACCCACCTGGATTCCCTGTTCT
  TTGAAGTGGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002686.3
• Summary: 'The product of this gene catalyzes the last step of the catecholamine biosynthesis pathway, which methylates norepinephrine to form epinephrine (adrenaline). The enzyme also has beta-carboline 2N-methyltransferase activity. This gene is thought to play a key step in regulating epinephrine production. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Nov 2012]'
• Locus ID: 5409