MGST2 (NM_002413) Human 3' UTR Clone

CAT#: SC200705

3`UTR clone of microsomal glutathione S-transferase 2 (MGST2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: MGST2
• Synonyms: GST2; MGST-II
• ACCN: NM_002413
• Insert Size: 121 bp
• Sequence Data:
  Insert Sequence

  >SC200705 3'UTR clone of NM_002413
  The sequence shown below is from the reference sequence of NM_002413. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAAACTGAGGCGGCAATTCTAACTTTTTCTCTTCCCTTTAATGCTTGCAGAAGCTGTTCCCACCATGAAG
  GTAATATGGTATCATTTGTTAAATAAAAATAAAGTCTTTATTCTGTTTTTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002413.3
• Summary: 'The MAPEG (Membrane Associated Proteins in Eicosanoid and Glutathione metabolism) family consists of six human proteins, several of which are involved in the production of leukotrienes and prostaglandin E, important mediators of inflammation. This gene encodes a protein which catalyzes the conjugation of leukotriene A4 and reduced glutathione to produce leukotriene C4. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2011]'
• Locus ID: 4258