NTH1 (NTHL1) (NM_002528) Human 3' UTR Clone

CAT#: SC200744

3`UTR clone of nth endonuclease III-like 1 (E. coli) (NTHL1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: NTHL1
• Synonyms: FAP3; hNTH1; NTH1; OCTS3
• ACCN: NM_002528
• Insert Size: 126 bp
• Sequence Data:
  Insert Sequence

  >SC200744 3'UTR clone of NM_002528
  The sequence shown below is from the reference sequence of NM_002528. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTGCCTCAACCAAGCCCTCTGCCCGGCCGCCCAGGGTCTCTGATGGCCGCATGGCTCTGGCCGAGGTGCC
  GCTGTGGCCACCGTCTGTGAAGTGGCTTTACGCTTCAGGAAGCCACGCCTGTTGAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002528.5
• Summary: 'The protein encoded by this gene is a DNA N-glycosylase of the endonuclease III family. Like a similar protein in E. coli, the encoded protein has DNA glycosylase activity on DNA substrates containing oxidized pyrimidine residues and has apurinic/apyrimidinic lyase activity. [provided by RefSeq, Oct 2008]'
• Locus ID: 4913