NDUFB9 (NM_005005) Human 3' UTR Clone

CAT#: SC200784

3`UTR clone of NADH dehydrogenase (ubiquinone) 1 beta subcomplex9 22kDa (NDUFB9) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: NDUFB9
• Synonyms: B22; CI-B22; LYRM3; MC1DN24; UQOR22
• ACCN: NM_005005
• Insert Size: 109 bp
• Sequence Data:
  Insert Sequence

  >SC200784 3'UTR clone of NM_005005
  The sequence shown below is from the reference sequence of NM_005005. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGTGGTGGTATATTGTGACCAGACCCCGGGAGCGGCCCATGTAGAAAGAGAGAGACCTCATCTTTCATGC
  TTGCAAGTGAAATATGTTACAGAACATGCACTTGCCCTA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_005005.2
• Summary: 'The protein encoded by this gene is a subunit of the mitochondrial oxidative phosphorylation complex I (nicotinamide adenine dinucleotide: ubiquinone oxidoreductase). Complex I is localized to the inner mitochondrial membrane and functions to dehydrogenate nicotinamide adenine dinucleotide and to shuttle electrons to coenzyme Q. Complex I deficiency is the most common defect found in oxidative phosphorylation disorders and results in a range of conditions, including lethal neonatal disease, hypertrophic cardiomyopathy, liver disease, and adult-onset neurodegenerative disorders. Pseudogenes of this gene are found on chromosomes five, seven and eight. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]'
• Locus ID: 4715