BSCL2 (NM_001130702) Human 3' UTR Clone
CAT#: SC200788
3`UTR clone of Berardinelli-Seip congenital lipodystrophy 2 (seipin) (BSCL2) transcript variant 3 for miRNA target validation
Product Images
Other products for "BSCL2"
Specifications
Product Data | |
Vector | pMirTarget |
Species | Human |
Transfection Reporter | RFP |
Assay Reporter | Luciferase |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Symbol | BSCL2 |
Synonyms | GNG3LG; HMN5; PELD; SPG17 |
ACCN | NM_001130702 |
Insert Size | 80 |
Sequence Data |
>SC200788 3'UTR clone of NM_001130702
The sequence shown below is from the reference sequence of NM_001130702. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon CAATTGGCAGAGCTCAGAATTCAAGCGATCGC ACCTGCTCTAGTTCCTGAAGAAAAGGGGCAGACTCCTCACATTCCAGCACTTTCCCACCTGACTCCTCTC CCCTCGTTTT ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG |
Restriction Sites | SgfI-MluI |
OTI Disclaimer | Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs). |
Reference Data | |
RefSeq | NM_001130702.1 |
Summary | This gene encodes the multi-pass transmembrane protein protein seipin. This protein localizes to the endoplasmic reticulum and may be important for lipid droplet morphology. Mutations in this gene have been associated with congenital generalized lipodystrophy type 2 or Berardinelli-Seip syndrome, a rare autosomal recessive disease characterized by a near absence of adipose tissue and severe insulin resistance. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. Naturally occurring read-through transcription occurs between this locus and the neighboring locus HNRNPUL2 (heterogeneous nuclear ribonucleoprotein U-like 2). [provided by RefSeq, Mar 2011] |
Locus ID | 26580 |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.