Cytochrome P450 3A5 (CYP3A5) (NM_000777) Human 3' UTR Clone

CAT#: SC200791

3`UTR clone of cytochrome P450 family 3 subfamily A polypeptide 5 (CYP3A5) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CYP3A5
• Synonyms: CP35; CYPIIIA5; P450PCN3; PCN3
• ACCN: NM_000777
• Insert Size: 110 bp
• Sequence Data:
  Insert Sequence

  >SC200791 3'UTR clone of NM_000777
  The sequence shown below is from the reference sequence of NM_000777. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAGATGGAACCCTAAGTGGAGAATGAGTTATTCTAAGGATTTCTACTTTGGTCTTCAAGAAAGCTGTGCC
  CCAGAACACCAGAGATTTCAACTTAGTCAATAAAACCTTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000777.2
• Summary: 'This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. The encoded protein metabolizes drugs as well as the steroid hormones testosterone and progesterone. This gene is part of a cluster of cytochrome P450 genes on chromosome 7q21.1. Two pseudogenes of this gene have been identified within this cluster on chromosome 7. Expression of this gene is widely variable among populations, and a single nucleotide polymorphism that affects transcript splicing has been associated with susceptibility to hypertensions. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]'
• Locus ID: 1577