DNA polymerase delta p50 (POLD2) (NM_006230) Human 3' UTR Clone

CAT#: SC200816

3`UTR clone of polymerase (DNA directed) delta 2 regulatory subunit 50kDa (POLD2) transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "POLD2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol POLD2
Synonyms delta 2; OTTHUMP00000024527; polymerase (DNA directed), delta 2, regulatory subunit; polymerase (DNA directed), delta 2, regulatory subunit (50kD); polymerase (DNA directed), delta 2, regulatory subunit 50kDa
ACCN NM_006230
Insert Size 136 bp
Sequence Data
>SC200816 3'UTR clone of NM_006230
The sequence shown below is from the reference sequence of NM_006230. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GGCAGAGGACGATGACCTGGGAGGCCTGGGGCTGGGCCCCTGACTCAAAAAAGTGGTTTTGACCAGAGAG
GCCCAGATGGAGGCTGTTCATTCCCTGCAGTGTCGGCATTGTAAATAAAGCCTGAGCACTTGCTGA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_006230.2
Summary 'This gene encodes the 50-kDa catalytic subunit of DNA polymerase delta. DNA polymerase delta possesses both polymerase and 3' to 5' exonuclease activity and plays a critical role in DNA replication and repair. The encoded protein is required for the stimulation of DNA polymerase delta activity by the processivity cofactor proliferating cell nuclear antigen (PCNA). Expression of this gene may be a marker for ovarian carcinomas. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 5. [provided by RefSeq, Mar 2012]'
Locus ID 5425

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.