MLC1SA (MYL6B) (NM_002475) Human 3' UTR Clone

CAT#: SC200854

3`UTR clone of myosin light chain 6B alkali smooth muscle and non-muscle (MYL6B) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: MYL6B
• Synonyms: MLC1SA
• ACCN: NM_002475
• Insert Size: 158
• Sequence Data:
  Insert Sequence

  >SC200854 3'UTR clone of NM_002475
  The sequence shown below is from the reference sequence of NM_002475. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCTGCATCAACTACGAGGCCTTCTTGAAACACATCCTAAGCGTCTGAGTGCTGCAGATCCAGTGGGGTCC
  GGACACTGGGCCCCGCAGGCGAAAGCACGTTCCAGCCACCAGGAGGCCACCTATTGTTTCAAAATAAAGA
  CTGGGTTCCTCTCTTGGT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_002475.3
• Summary: Myosin is a hexameric ATPase cellular motor protein. It is composed of two heavy chains, two nonphosphorylatable alkali light chains, and two phosphorylatable regulatory light chains. This gene encodes a myosin alkali light chain expressed in both slow-twitch skeletal muscle and in nonmuscle tissue. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2010]
• Locus ID: 140465