Syntaxin 8 (STX8) (NM_004853) Human 3' UTR Clone

CAT#: SC200890

3`UTR clone of syntaxin 8 (STX8) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: STX8
• Synonyms: CARB
• ACCN: NM_004853
• Insert Size: 130
• Sequence Data:
  Insert Sequence

  >SC200890 3'UTR clone of NM_004853
  The sequence shown below is from the reference sequence of NM_004853. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGCTGCTTGTGGCTATCGTGGTTGTTGCAGTCTGGCCGACCAACTGATGGCAGTAAAGAGACCACCAGCA
  GTGACACCTGGCAATGACAGATGCAAGCCCAACACCCTTTTGGTACGCAAAACCTGCTCT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_004853.1
• Summary: The gene is a member of the syntaxin family. The encoded protein is involved in protein trafficking from early to late endosomes via vesicle fusion and exocytosis. A related pseudogene has been identified on chromosome 12. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
• Locus ID: 9482