BAT3 (BAG6) (NM_080702) Human 3' UTR Clone

CAT#: SC200914

3`UTR clone of HLA-B associated transcript 3 (BAT3) transcript variant 2 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "BAG6"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol BAG6
Synonyms BAG-6; BAT3; D6S52E; G3
ACCN NM_080702
Insert Size 113
Sequence Data
>SC200914 3'UTR clone of NM_080702
The sequence shown below is from the reference sequence of NM_080702. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CCTTTGCTGATGATCCTTAGCTCTTTGCTCTATGGCCCTTCCTCATCAGGGGACCGTTTCCCCCCTCTTC
CTTCACAGTATTTAAGAAATAAAAGTCGGATTTTTCTGGCTGC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_080702.2
Summary This gene was first characterized as part of a cluster of genes located within the human major histocompatibility complex class III region. This gene encodes a nuclear protein that is cleaved by caspase 3 and is implicated in the control of apoptosis. In addition, the protein forms a complex with E1A binding protein p300 and is required for the acetylation of p53 in response to DNA damage. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 7917

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.