BAT3 (BAG6) (NM_004639) Human 3' UTR Clone

CAT#: SC200916

3`UTR clone of HLA-B associated transcript 3 (BAT3) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: BAG6
• Synonyms: BAG-6; BAT3; D6S52E; G3
• ACCN: NM_004639
• Insert Size: 113
• Sequence Data:
  Insert Sequence

  >SC200916 3'UTR clone of NM_004639
  The sequence shown below is from the reference sequence of NM_004639. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCTTTGCTGATGATCCTTAGCTCTTTGCTCTATGGCCCTTCCTCATCAGGGGACCGTTTCCCCCCTCTTC
  CTTCACAGTATTTAAGAAATAAAAGTCGGATTTTTCTGGCTGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_004639.3
• Summary: This gene was first characterized as part of a cluster of genes located within the human major histocompatibility complex class III region. This gene encodes a nuclear protein that is cleaved by caspase 3 and is implicated in the control of apoptosis. In addition, the protein forms a complex with E1A binding protein p300 and is required for the acetylation of p53 in response to DNA damage. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
• Locus ID: 7917