PSMA7 (NM_002792) Human 3' UTR Clone

CAT#: SC200955

3`UTR clone of proteasome (prosome macropain) subunit alpha type 7 (PSMA7) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PSMA7
• Synonyms: C6; HEL-S-276; HSPC; RC6-1; XAPC7
• ACCN: NM_002792
• Insert Size: 129 bp
• Sequence Data:
  Insert Sequence

  >SC200955 3'UTR clone of NM_002792
  The sequence shown below is from the reference sequence of NM_002792. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGAAACAAAAGAAAGCATCATGATGAATAAAATGTCTTTGCTTGTAATTTTTAAATTCATATCAATCATG
  GATGAGTCTCGATGTGTAGGCCTTTCCATTCCATTTATTCACACTGAGTGTCCTACAAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002792.2
• Summary: 'The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. This gene encodes a member of the peptidase T1A family that functions as a 20S core alpha subunit. The encoded protein interacts with the hepatitis B virus X protein and plays a role in regulating hepatitis C virus internal ribosome entry site (IRES) activity, an activity essential for viral replication. The encoded protein also plays a role in the cellular stress response by regulating hypoxia-inducible factor-1alpha. A pseudogene of this gene is located on the long arm of chromosome 9. [provided by RefSeq, Jul 2012]'
• Locus ID: 5688