CysLT1 (CYSLTR1) (NM_006639) Human 3' UTR Clone

CAT#: SC200960

3`UTR clone of cysteinyl leukotriene receptor 1 (CYSLTR1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CYSLTR1
• Synonyms: CYSLT1; CYSLT1R; CYSLTR; HMTMF81
• ACCN: NM_006639
• Insert Size: 118
• Sequence Data:
  Insert Sequence

  >SC200960 3'UTR clone of NM_006639
  The sequence shown below is from the reference sequence of NM_006639. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTTTGCCAGAAAAAGGAGAAGAAATATGTAAAGTATAGTTTAAACCCATTTCCAGTCCAAACCAATGAAA
  ATAGTTTCCCAAATAAGTATTTTGTCAAATCATTTACAAAAAAAATAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_006639.2
• Summary: This gene encodes a member of the G-protein coupled receptor 1 family. The encoded protein is a receptor for cysteinyl leukotrienes, and is involved in mediating bronchoconstriction via activation of a phosphatidylinositol-calcium second messenger system. Activation of the encoded receptor results in contraction and proliferation of bronchial smooth muscle cells, eosinophil migration, and damage to the mucus layer in the lung. Upregulation of this gene is associated with asthma and dysregulation may also be implicated in cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
• Locus ID: 10800