UGT2B11 (NM_001073) Human 3' UTR Clone

CAT#: SC200963

3`UTR clone of UDP glucuronosyltransferase 2 family polypeptide B11 (UGT2B11) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: UGT2B11
• Synonyms: MGC129611; MGC129612
• ACCN: NM_001073
• Insert Size: 148
• Sequence Data:
  Insert Sequence

  >SC200963 3'UTR clone of NM_001073
  The sequence shown below is from the reference sequence of NM_001073. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTGGAAGTTTGCTAGAAAAGGGAAGAAGGGAAAAAGAGATTAGTTATGTCTGACATTTGAAGCTGGAAAA
  CCAGATAGATAGGACAACTTCAGTTTATTCCAGCAAGAAAGAAAAGATTGTTATGCAAGATTTCTTTCTT
  CCTGTGAC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001073.1
• Summary: UDPGT is of major importance in the conjugation and subsequent elimination of potentially toxic xenobiotics and endogenous compounds. [UniProtKB/Swiss-Prot Function]
• Locus ID: 10720