CHPT1 (NM_020244) Human 3' UTR Clone

CAT#: SC200975

3`UTR clone of choline phosphotransferase 1 (CHPT1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CHPT1
• Synonyms: CPT; CPT1
• ACCN: NM_020244
• Insert Size: 130
• Sequence Data:
  Insert Sequence

  >SC200975 3'UTR clone of NM_020244
  The sequence shown below is from the reference sequence of NM_020244. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGAGTCATCAGAATAACATGGATTGAAGAGACTTCCGAACACTTGCTATCTCTTGCTGCTGCTGTTTCAT
  GGAAGGAGATATTAAACATTTGTTTAATTTTTATTTAAGTGTTATACCTATTTCAGCAAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_020244.2
• Summary: Catalyzes phosphatidylcholine biosynthesis from CDP-choline. It thereby plays a central role in the formation and maintenance of vesicular membranes. [UniProtKB/Swiss-Prot Function]
• Locus ID: 56994