ANT 1 (PRPF6) (NM_012469) Human 3' UTR Clone

CAT#: SC201011

3`UTR clone of PRP6 pre-mRNA processing factor 6 homolog (S. cerevisiae) (PRPF6) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PRPF6
• Synonyms: ANT-1; ANT1; C20orf14; hPrp6; Prp6; RP60; SNRNP102; TOM; U5-102K
• ACCN: NM_012469
• Insert Size: 101
• Sequence Data:
  Insert Sequence

  >SC201011 3'UTR clone of NM_012469
  The sequence shown below is from the reference sequence of NM_012469. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CGCATCAAGAACACCTTCTGATTGAGCGGTTGCCATGGCCGGTCTCCGTGGGGCAGGGTTGGGCCGCATG
  TGGAAGGGCTCTGAGCTGTGTCCTCCTTCAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_012469.3
• Summary: The protein encoded by this gene appears to be involved in pre-mRNA splicing, possibly acting as a bridging factor between U5 and U4/U6 snRNPs in formation of the spliceosome. The encoded protein also can bind androgen receptor, providing a link between transcriptional activation and splicing. [provided by RefSeq, Jul 2008]
• Locus ID: 24148