EP1 (PTGER1) (NM_000955) Human 3' UTR Clone

CAT#: SC201077

3`UTR clone of prostaglandin E receptor 1 (subtype EP1) 42kDa (PTGER1) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "PTGER1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol PTGER1
Synonyms EP1
ACCN NM_000955
Insert Size 96 bp
Sequence Data
>SC201077 3'UTR clone of NM_000955
The sequence shown below is from the reference sequence of NM_000955. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CGGCCTCAGCCACTTCTAAGCACAACCAGAGGCCCAACGACTAAGCCAGCCCACCCTGGGCTGGGCCCAG
GTGCGCGGCGCAGAGCCTTTGGGAAT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_000955.2
Summary 'The protein encoded by this gene is a member of the G protein-coupled receptor family. This protein is one of four receptors identified for prostaglandin E2 (PGE2). Through a phosphatidylinositol-calcium second messenger system, G-Q proteins mediate this receptor's activity. Knockout studies in mice suggested a role of this receptor in mediating algesia and in regulation of blood pressure. Studies in mice also suggested that this gene may mediate adrenocorticotropic hormone response to bacterial endotoxin. [provided by RefSeq, Jul 2008]'
Locus ID 5731

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.