Peroxiredoxin 2 (PRDX2) (NM_181738) Human 3' UTR Clone

CAT#: SC201096

3`UTR clone of peroxiredoxin 2 (PRDX2) nuclear gene encoding mitochondrial protein transcript variant 3 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "PRDX2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol PRDX2
Synonyms NKEFB; PRP; PRX2; PRXII; PTX1; TDPX1; TPX1; TSA
ACCN NM_181738
Insert Size 178 bp
Sequence Data
>SC201096 3'UTR clone of NM_181738
The sequence shown below is from the reference sequence of NM_181738. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CATTGCCGCCCAAGTCTTTAAGGATGATGACAGTAATTAGCATTTGACAACTAGTTGCCTGGTATATAGA
GTTGCAGATGCAACTCAGATGCAACTCTATCTACTCTATGTACTTAGTTCCCAGGAGGGAGGCTGTGCTG
CCCTATTTCATGAAGATGGAAACTCCAGTTCACCGAAG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_181738.1
Summary 'This gene encodes a member of the peroxiredoxin family of antioxidant enzymes, which reduce hydrogen peroxide and alkyl hydroperoxides. The encoded protein plays an antioxidant protective role in cells, and it may contribute to the antiviral activity of CD8(+) T-cells. The crystal structure of this protein has been resolved to 2.7 angstroms. This protein prevents hemolytic anemia from oxidative stress by stabilizing hemoglobin, thus making this gene a therapeutic target for patients with hemolytic anemia. This protein may have a proliferative effect and play a role in cancer development or progression. Related pseudogenes have been identified on chromosomes 5, 6, 10 and 13. [provided by RefSeq, Mar 2013]'
Locus ID 7001

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.