TUBA6 (TUBA1C) (NM_032704) Human 3' UTR Clone

CAT#: SC201103

3`UTR clone of tubulin alpha 1c (TUBA1C) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TUBA1C
• Synonyms: bcm948; TUBA6
• ACCN: NM_032704
• Insert Size: 122
• Sequence Data:
  Insert Sequence

  >SC201103 3'UTR clone of NM_032704
  The sequence shown below is from the reference sequence of NM_032704. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAGATAGTGCTGACGGAGAGGATGAGGGTGAAGAGTATTAACCTGTGTGCTGTACTTTTACACTCCTTTG
  TCTTGGAACTGTCTTATTTTTGTTCTGTAAATGTCTATTGCCGTAAATTGTT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_032704.3
• Summary: Tubulin is the major constituent of microtubules. It binds two moles of GTP, one at an exchangeable site on the beta chain and one at a non-exchangeable site on the alpha chain. [UniProtKB/Swiss-Prot Function]
• Locus ID: 84790