ACTN3 (NM_001104) Human 3' UTR Clone

CAT#: SC201154

3`UTR clone of actinin alpha 3 (ACTN3) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ACTN3"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ACTN3
Synonyms ACTN3D
ACCN NM_001104
Insert Size 149 bp
Sequence Data
>SC201154 3'UTR clone of NM_001104
The sequence shown below is from the reference sequence of NM_001104. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CTTCTCCAGTGCCCTCTATGGGGAGAGCGACCTTTGACCCCAACCACTGAGGTTCTCTATGCAAGATGGA
GAGAGGATGCACCCTGTGGCTGATCCCATCCGTCCCTCGGAGCAAGGGCCTAAGAGAAAAGCCAGCCAAG
TGCTTCTGA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001104.1
Summary 'This gene encodes a member of the alpha-actin binding protein gene family. The encoded protein is primarily expressed in skeletal muscle and functions as a structural component of sarcomeric Z line. This protein is involved in crosslinking actin containing thin filaments. An allelic polymorphism in this gene results in both coding and non-coding variants; the reference genome represents the coding allele. The non-functional allele of this gene is associated with elite athlete status. [provided by RefSeq, Feb 2014]'
Locus ID 89

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.