MDA5 (IFIH1) (NM_022168) Human 3' UTR Clone

CAT#: SC201156

3`UTR clone of interferon induced with helicase C domain 1 (IFIH1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: IFIH1
• Synonyms: AGS7; Hlcd; IDDM19; MDA-5; MDA5; RLR-2; SGMRT1
• ACCN: NM_022168
• Insert Size: 139
• Sequence Data:
  Insert Sequence

  >SC201156 3'UTR clone of NM_022168
  The sequence shown below is from the reference sequence of NM_022168. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAATCTTGACTATTCAGAATGCTGTTTATTTAGTGATGAGGATTAGCACTTGATTGAAGATTCTTTTAAA
  ATACTATCAGTTAAACATTTAATATGATTATGATTAATGTATTCATTATGCTACAGAACTGACATAAGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_022168.2
• Summary: DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein that is upregulated in response to treatment with beta-interferon and a protein kinase C-activating compound, mezerein. Irreversible reprogramming of melanomas can be achieved by treatment with both these agents; treatment with either agent alone only achieves reversible differentiation. Genetic variation in this gene is associated with diabetes mellitus insulin-dependent type 19. [provided by RefSeq, Jul 2012]
• Locus ID: 64135