Cytochrome C Oxidase subunit VIb (COX6B1) (NM_001863) Human 3' UTR Clone

CAT#: SC201196

3`UTR clone of cytochrome c oxidase subunit Vib polypeptide 1 (ubiquitous) (COX6B1) nuclear gene encoding mitochondrial protein for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: COX6B1
• Synonyms: COX6B; COXG; COXVIb1
• ACCN: NM_001863
• Insert Size: 169 bp
• Sequence Data:
  Insert Sequence

  >SC201196 3'UTR clone of NM_001863
  The sequence shown below is from the reference sequence of NM_001863. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GATGAGCAACGGGCTGAAGGCACGTTTCCCGGGAAGATCTGAACTGGCTGCATCTCCCTTTCCTCTGTCC
  TCCATCCTTCTCCCAGGATGGTGAAGGGGGACCTGGTACCCAGTGATCCCCACCCCAGGATCCTAAATCA
  TGACTTACCTGCTAATAAAAACTCATTGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001863.4
• Summary: 'Cytochrome c oxidase (COX), the terminal enzyme of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. It is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may be involved in the regulation and assembly of the complex. This nuclear gene encodes subunit VIb. Mutations in this gene are associated with severe infantile encephalomyopathy. Three pseudogenes COX6BP-1, COX6BP-2 and COX6BP-3 have been found on chromosomes 7, 17 and 22q13.1-13.2, respectively. [provided by RefSeq, Jan 2010]'
• Locus ID: 1340