Casein Kinase 2 beta (CSNK2B) (NM_001320) Human 3' UTR Clone

CAT#: SC201247

3`UTR clone of casein kinase 2 beta polypeptide (CSNK2B) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CSNK2B
• Synonyms: CK2B; CK2N; Ckb1; Ckb2; CSK2B; G5A
• ACCN: NM_001320
• Insert Size: 132 bp
• Sequence Data:
  Insert Sequence

  >SC201247 3'UTR clone of NM_001320
  The sequence shown below is from the reference sequence of NM_001320. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCAGTCAAGACGATTCGCTGATTCCCTCCCCCACCTGTCCTGCAGTCTTTGACTTTTCCTTTCTTTTTTG
  CCACCCTTTCAGGAACCCTGTATGGTTTTTAGTTTAAATTAAAGGAGTCGTTATTGTGGTGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001320.5
• Summary: 'This gene encodes the beta subunit of casein kinase II, a ubiquitous protein kinase which regulates metabolic pathways, signal transduction, transcription, translation, and replication. The enzyme is composed of three subunits, alpha, alpha prime and beta, which form a tetrameric holoenzyme. The alpha and alpha prime subunits are catalytic, while the beta subunit serves regulatory functions. The enzyme localizes to the endoplasmic reticulum and the Golgi apparatus. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]'
• Locus ID: 1460