MGST3 (NM_004528) Human 3' UTR Clone

CAT#: SC201259

3`UTR clone of microsomal glutathione S-transferase 3 (MGST3) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "MGST3"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol MGST3
Synonyms GST-III
ACCN NM_004528
Insert Size 134 bp
Sequence Data
>SC201259 3'UTR clone of NM_004528
The sequence shown below is from the reference sequence of NM_004528. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TGGACCCAAATGCTGCCATTAAAGAATTATAGGGGTTTAAAAACTCTCATTCATTTTAAATGACTTACCT
TTATTTCCAGTTACATTTTTTTTCTAAATATAATAAAAACTTACCTGGCATCAGCCTCATACCT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_004528.2
Summary 'This gene encodes a member of the MAPEG (Membrane Associated Proteins in Eicosanoid and Glutathione metabolism) protein family. Members of this family are involved in the production of leukotrienes and prostaglandin E, important mediators of inflammation. This gene encodes an enzyme which catalyzes the conjugation of leukotriene A4 and reduced glutathione to produce leukotriene C4. This enzyme also demonstrates glutathione-dependent peroxidase activity towards lipid hydroperoxides.[provided by RefSeq, May 2011]'
Locus ID 4259

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.