PTPN22 (NM_012411) Human 3' UTR Clone

CAT#: SC201270

3`UTR clone of protein tyrosine phosphatase non-receptor type 22 (lymphoid) (PTPN22) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PTPN22
• Synonyms: LYP; LYP1; LYP2; PEP; PTPN8; PTPN22.5; PTPN22.6
• ACCN: NM_012411
• Insert Size: 170
• Sequence Data:
  Insert Sequence

  >SC201270 3'UTR clone of NM_012411
  The sequence shown below is from the reference sequence of NM_012411. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTCCGAAGTCCTAAATCAGGTAAAAATTTCTCTTGGCTTTAGATGACATTTAGCCCTAAGATTGGAAGAA
  TGGTTCGTTAAGTTTAGAGTAATTCACTTCAGGAAGTTACTTGGTTCCCATAATAGCTTCCAGTATTCAT
  TGATTTATTTCTGGCTTTCCCAGACTAGAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_012411.3
• Summary: This gene encodes of member of the non-receptor class 4 subfamily of the protein-tyrosine phosphatase family. The encoded protein is a lymphoid-specific intracellular phosphatase that associates with the molecular adapter protein CBL and may be involved in regulating CBL function in the T-cell receptor signaling pathway. Mutations in this gene may be associated with a range of autoimmune disorders including Type 1 Diabetes, rheumatoid arthritis, systemic lupus erythematosus and Graves' disease. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Mar 2009]
• Locus ID: 26191