HSP27 (HSPB1) (NM_001540) Human 3' UTR Clone

CAT#: SC201272

3`UTR clone of heat shock 27kDa protein 1 (HSPB1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: HSPB1
• Synonyms: CMT2F; HEL-S-102; HMN2B; HS.76067; Hsp25; HSP27; HSP28; SRP27
• ACCN: NM_001540
• Insert Size: 143 bp
• Sequence Data:
  Insert Sequence

  >SC201272 3'UTR clone of NM_001540
  The sequence shown below is from the reference sequence of NM_001540. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ATGAGACTGCCGCCAAGTAAAGCCTTAGCCCGGATGCCCACCCCTGCTGCCGCCACTGGCTGTGCCTCCC
  CCGCCACCTGTGTGTTCTTTTGATACATTTATCTTCTGTTTTTCTCAAATAAAGTTCAAAGCAACCACCT
  GTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001540.3
• Summary: 'This gene encodes a member of the small heat shock protein (HSP20) family of proteins. In response to environmental stress, the encoded protein translocates from the cytoplasm to the nucleus and functions as a molecular chaperone that promotes the correct folding of other proteins. This protein plays an important role in the differentiation of a wide variety of cell types. Expression of this gene is correlated with poor clinical outcome in multiple human cancers, and the encoded protein may promote cancer cell proliferation and metastasis, while protecting cancer cells from apoptosis. Mutations in this gene have been identified in human patients with Charcot-Marie-Tooth disease and distal hereditary motor neuropathy. [provided by RefSeq, Aug 2017]'
• Locus ID: 3315