CCL14 (NM_032963) Human 3' UTR Clone

CAT#: SC201322

3`UTR clone of chemokine (C-C motif) ligand 14 (CCL14) transcript variant 3 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CCL14
• Synonyms: CC-1; CC-3; CKB1; HCC-1; HCC-1(1-74); HCC-1/HCC-3; HCC-3; MCIF; NCC-2; NCC2; SCYA14; SCYL2; SY14
• ACCN: NM_032963
• Insert Size: 166 bp
• Sequence Data:
  Insert Sequence

  >SC201322 3'UTR clone of NM_032963
  The sequence shown below is from the reference sequence of NM_032963. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACAAGTGGGTCCAGGACTATATCAAGGACATGAAGGAGAACTGAGTGACCCAGAAGGGGTGGCGAAGGCA
  CAGCTCAGAGACATAAAGAGAAGATGCCAAGGCCCCCTCCTCCACCCACCGCTAACTCTCAGCCCCAGTC
  ACCCTCTTGGAGCTTCCCTGCTTTGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_032963.3
• Summary: 'This gene, chemokine (C-C motif) ligand 14, is one of several CC cytokine genes clustered on 17q11.2. The CC cytokines are secreted proteins characterized by two adjacent cysteines. The cytokine encoded by this gene induces changes in intracellular calcium concentration and enzyme release in monocytes. Multiple transcript variants encoding different isoforms have been found for this gene. Read-through transcripts are also expressed that include exons from the upstream cytokine gene, chemokine (C-C motif) ligand 15, and are represented as GeneID: 348249. [provided by RefSeq, Dec 2009]'
• Locus ID: 6358