N acetylglucosamine kinase (NAGK) (NM_017567) Human 3' UTR Clone

CAT#: SC201373

3`UTR clone of N-acetylglucosamine kinase (NAGK) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: NAGK
• Synonyms: GNK; HSA242910
• ACCN: NM_017567
• Insert Size: 174
• Sequence Data:
  Insert Sequence

  >SC201373 3'UTR clone of NM_017567
  The sequence shown below is from the reference sequence of NM_017567. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ATAGCGCCAATGCCATTGCCTTCTATTCCTACACCTTTTCCTAGGGGGCTGGTCCCGGCTCCACCCCCTC
  CAAGCTCAGTGGACACTGGGTCTGAAAGGAAGGAGTCTTTTGCTTCCTTTCTCCTTTTTACAAAAACAAA
  CATAGAAGAAAATAAATGCACTTTATCCACTCCC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_017567.3
• Summary: This gene encodes a member of the N-acetylhexosamine kinase family. The encoded protein catalyzes the conversion of N-acetyl-D-glucosamine to N-acetyl-D-glucosamine 6-phosphate, and is the major mammalian enzyme which recovers amino sugars. [provided by RefSeq, Nov 2011]
• Locus ID: 55577