ICA1 (NM_001136020) Human 3' UTR Clone

CAT#: SC201385

3`UTR clone of islet cell autoantigen 1 69kDa (ICA1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ICA1
• Synonyms: ICA69; ICAp69
• ACCN: NM_001136020
• Insert Size: 179 bp
• Sequence Data:
  Insert Sequence

  >SC201385 3'UTR clone of NM_001136020
  The sequence shown below is from the reference sequence of NM_001136020. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGAAAACCGATAAAGAACACGAATTGCTCAATGCATGAATCTGTACCCTTCGGGAGGGCACTCACATGCC
  GCCCCCAGCAGCTCCCCTGGGGGCTAGCAGAAGTATAAAGTGATCAGTATGCTGTTTTAATAATTATGTG
  CCATTTTAATAAAATGAAAGGGTCAACGGCCCTGTTTAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001136020.1
• Summary: 'This gene encodes a protein with an arfaptin homology domain that is found both in the cytosol and as membrane-bound form on the Golgi complex and immature secretory granules. This protein is believed to be an autoantigen in insulin-dependent diabetes mellitus and primary Sjogren's syndrome. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Feb 2013]'
• Locus ID: 3382