GABRR2 (NM_002043) Human 3' UTR Clone

CAT#: SC201392

3`UTR clone of gamma-aminobutyric acid (GABA) receptor rho 2 (GABRR2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GABRR2
• Synonyms: GABA-C receptor, rho-2 subunit; gamma-aminobutyric acid (GABA) receptor, rho 2; OTTHUMP00000040625
• ACCN: NM_002043
• Insert Size: 163 bp
• Sequence Data:
  Insert Sequence

  >SC201392 3'UTR clone of NM_002043
  The sequence shown below is from the reference sequence of NM_002043. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TTGGTCAGTGTTTTCCTAGGGGCTCCAAGGCTGTTCCTAGAAGAGGGCATAGACATCGAGGGGGCCTGGC
  CAGTCATTGACAGACGGACTTGTTGACCACACGCCCCTCACCAAACAATGCAGCAGCTACTGGACCACCC
  TGAGCAGCACTCATCTCTCAGAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002043.2
• Summary: 'Gamma-aminobutyric acid (GABA) is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA receptors, which are ligand-gated chloride channels. The protein encoded by this gene is a member of the rho subunit family and is a component of the GABA type A receptor complex. This gene exists on chromosome 6q next to the gene encoding the rho 1 subunit of the GABA type A receptor, in a region thought to be associated with susceptibility for psychiatric disorders and epilepsy. Polymorphisms in this gene may also be associated with alcohol dependence, and general cognitive ability. [provided by RefSeq, Apr 2016]'
• Locus ID: 2570