GABPB2 (GABPB1) (NM_002041) Human 3' UTR Clone

CAT#: SC201419

3`UTR clone of GA binding protein transcription factor beta subunit 1 (GABPB1) transcript variant gamma-1 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "GABPB1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol GABPB1
Synonyms BABPB2; E4TF1; E4TF1-47; E4TF1-53; E4TF1B; GABPB; GABPB-1; GABPB2; NRF2B1; NRF2B2
ACCN NM_002041
Insert Size 140 bp
Sequence Data
>SC201419 3'UTR clone of NM_002041
The sequence shown below is from the reference sequence of NM_002041. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TGTGCTTTGCCGCAGTCATCCAAAATAAATTCAATTTTTTTTGTCTTTTATATTTATTACTGACAGTATT
GTTTTGATACAGAATGAAAGTGCGTAGTATTTTCATTTTGTTTATTTTTGCCTTATACATATAGCAAGCC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_002041.4
Summary 'This gene encodes the GA-binding protein transcription factor, beta subunit. This protein forms a tetrameric complex with the alpha subunit, and stimulates transcription of target genes. The encoded protein may be involved in activation of cytochrome oxidase expression and nuclear control of mitochondrial function. The crystal structure of a similar protein in mouse has been resolved as a ternary protein complex. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]'
Locus ID 2553

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.