MSH5 (NM_025259) Human 3' UTR Clone

CAT#: SC201463

3`UTR clone of mutS homolog 5 (E. coli) (MSH5) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: MSH5
• Synonyms: G7; MUTSH5; NG23; POF13
• ACCN: NM_025259
• Insert Size: 187 bp
• Sequence Data:
  Insert Sequence

  >SC201463 3'UTR clone of NM_025259
  The sequence shown below is from the reference sequence of NM_025259. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ATGAGCCAGGAAGTGCTGCCTGCTGCCACCAGCATCCTCTGAGAGTCCTTCCAGTGTCCTCCCCAGCCTC
  CTGAGACTCCGGTGGGCTGCCATGCCCTCTTTGTTTCCTTATCTCCCTCAGACGCAGAGTTTTTAGTTTC
  TCTAGAAATTTTGTTTCATATTAGGAATAAAGTTTATTTTGAAGAAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_025259.5
• Summary: 'This gene encodes a member of the mutS family of proteins that are involved in DNA mismatch repair and meiotic recombination. This protein is similar to a Saccharomyces cerevisiae protein that participates in segregation fidelity and crossing-over events during meiosis. This protein plays a role in promoting ionizing radiation-induced apoptosis. This protein forms hetero-oligomers with another member of this family, mutS homolog 4. Polymorphisms in this gene have been linked to various human diseases, including IgA deficiency, common variable immunodeficiency, and premature ovarian failure. Alternative splicing results multiple transcript variants. Read-through transcription also exists between this gene and the downstream chromosome 6 open reading frame 26 (C6orf26) gene. [provided by RefSeq, Feb 2011]'
• Locus ID: 4439