MSH5 (NM_002441) Human 3' UTR Clone

CAT#: SC201466

3`UTR clone of mutS homolog 5 (E. coli) (MSH5) transcript variant 3 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "MSH5"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol MSH5
Synonyms G7; MUTSH5; NG23; POF13
ACCN NM_002441
Insert Size 187 bp
Sequence Data
>SC201466 3'UTR clone of NM_002441
The sequence shown below is from the reference sequence of NM_002441. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

ATGAGCCAGGAAGTGCTGCCTGCTGCCACCAGCATCCTCTGAGAGTCCTTCCAGTGTCCTCCCCAGCCTC
CTGAGACTCCGGTGGGCTGCCATGCCCTCTTTGTTTCCTTATCTCCCTCAGACGCAGAGTTTTTAGTTTC
TCTAGAAATTTTGTTTCATATTAGGAATAAAGTTTATTTTGAAGAAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_002441.4
Summary 'This gene encodes a member of the mutS family of proteins that are involved in DNA mismatch repair and meiotic recombination. This protein is similar to a Saccharomyces cerevisiae protein that participates in segregation fidelity and crossing-over events during meiosis. This protein plays a role in promoting ionizing radiation-induced apoptosis. This protein forms hetero-oligomers with another member of this family, mutS homolog 4. Polymorphisms in this gene have been linked to various human diseases, including IgA deficiency, common variable immunodeficiency, and premature ovarian failure. Alternative splicing results multiple transcript variants. Read-through transcription also exists between this gene and the downstream chromosome 6 open reading frame 26 (C6orf26) gene. [provided by RefSeq, Feb 2011]'
Locus ID 4439

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.